Workarounds for errors during the FASTQ file processing.

Though fastp gegnerally supports adapter sequences, it might fail to recognize the adapter sequence if you use a not-so-common kit. In such cases, please let fastp know the adapter sequence in the options setting.

--adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Even after you remove the adapter, you still might need to use length filter options when you see many reads of unexpected artifacts in the fastq. The global trimming options may work better in some cases. Please refer to details of fastp options. The order of options is critical, so please find the proper sequence of options through a series of trials and errors. If you need help, we support you as RNA-Seq Data Analysis Support Service.

If you still see errors, please try the following workarounds.

  1. Remove spaces, symbols, and two-byte characters from paths of executable files, reference data, and FASTQ files.
  2. HISAT2 generates a vast number of temporary files during the process and hogs a lot of disk space. So have the fastq files on the disk with enough free disk space, which we recommend more than 1TB.
  3. Pause the automatic file backup programs (e.g., Time Machine, "Backup and Sync") or indexing while the FASTQ processing is running. Also, disconnect the computer from the network while it's executing.
  4. Try processing one by one. Even if you fail for a bulk execution, it could still work fine with one or a small number of samples.
  5. Work with another computer. Please choose a machine with enough RAM and free disk space. HISAT2 hogs the disk a lot if a FASTQ file is enormous. Please monitor the resources while it's running. Or maybe you can switch to the other OS (Windows or Mac).
  6. In cases, though the FASTQ pipeline worked, it doesn't work anymore after some point, you might recover by resetting or re-installing ubuntu. Please google "how to reset ubuntu on windows 10" to find instructions. You don't need to re-install fastp, HISAT2, StringTie.
  7. If the CPU spec is too high (more than 16 cores,) fastp might fail to control multi-threading. In such a case, clear the "High-speed processing. (It can slow other software.)" and rerun.
  8. When you get the error executing HISAT2 with Windows 11, please open Command Prompt, run the "wsl" command, and keep it open during Subio Platform imports FASTQ files.

When you try all the workarounds, and still you can't solve the problem, please consider ordering RNA-Seq Data Analysis Support Service or Data Analysis Service.